Knock-In Cell Line

Knock-in cell lines are generated by precisely inserting exogenous DNA fragments, such as fluorescent tags, reporter genes, or pathogenic mutation sequences, into specific sites of a target gene. This approach allows controlled modification of gene function and protein expression while maintaining the gene’s native regulatory environment. Compared with traditional overexpression systems, knock-in models more accurately reflect endogenous gene expression levels and regulatory mechanisms, making them valuable tools for studying gene function, disease mechanisms, and drug responses.

Leveraging EDITGENE’s optimized CRISPR/Cas9 and HDR platforms, along with efficient homology arm design and single-clone screening workflows, we provide customized knock-in cell line services. Our solutions feature high efficiency, low off-target rates, and comprehensive validation, ensuring the generation of stable and reliable cell models.

Service Details

Cell Types Various cell types, including tumor, conventional, stem, primary, and immortalized cell lines.
Service Options Targeted knock-in of fluorescent proteins (EGFP, Luc, mCherry, etc.) / Targeted knock-in of tag proteins (Flag, HA, Myc, HiBiT, etc.) / Targeted knock-in at specific sites of a gene of interest / Gene point mutations
Delivery Standard One monoclonal stable cell line (2 cryovials, 1×10⁶ cells per vial)
Turnaround/Price As fast as 8 weeks,as low as $4500   Available upon request – chat with us online

Technical Principle

With over a decade of gene editing experience, EDITGENE has developed four knock-in technologies—HES-KI, CRISPaint, Bingo™, and CRISPR/HDR—capable of meeting diverse knock-in requirements. These platforms achieve both high efficiency and precision, removing barriers to the successful generation of knock-in cell lines.

Service Efficiency Advantages Applicable Scenarios  
CRISPR/HDR 5-30% Highly versatile – ideal for introducing point mutations or inserting DNA fragments Actively dividing cells

CRISPR/HDR Technology Overview

CRISPR/HDR is a gene editing approach that integrates foreign DNA through the CRISPR system and the cell’s homology-directed repair (HDR) pathway. The sgRNA guides Cas9 to a specific target site, where it introduces a double-strand break (DSB). A donor DNA template containing homology arms is then precisely inserted at the break site through HDR, enabling accurate gene knock-in.

 

CRISPR/HDR Technical Advantages

 

Highly flexible
By adjusting the sgRNA and donor template, foreign gene sequences can be inserted at various genomic locations
Highly accurate
The HDR pathway allows precise integration of the donor DNA at the cut site, minimizing unexpected mutations (indels) at the junction

CRISPR/HDR Workflow

 

CRISPaint 20-50% Works independently of the cell cycle Cells with slow or infrequent division

CRISPaint Technology Overview

CRISPaint is a gene knock-in technique based on the CRISPR-Cas9 system. It leverages the cell's own non-homologous end joining (NHEJ) repair mechanism to insert exogenous DNA fragments at the specified C-terminal position of a target gene, without relying on homologous recombination (HDR). The CRISPaint design is highly flexible, making it suitable for various gene function studies and genome editing applications. 

1. CRISPR-Cas9-Mediated Double-Strand Break (DSB)
The target sgRNA plasmid cleaves specific sites in the gene, causing DNA double-strand breaks and activating the cell's DNA repair mechanisms.


2. Universal Donor Vector Design
CRISPaint uses a universal donor DNA template to implement a flexible knock-in strategy through the following key components:
Frame sgRNA plasmid: Cuts the donor plasmid to linearize it within the cell. Three types of frame sgRNAs are available to ensure correct open reading frame (ORF) expression of the inserted gene.
Universal Donor plasmid: Contains the gene sequence to be inserted (e.g., a fluorescent protein) along with the target sequences for the three types of Donor sgRNAs.

CRISPaint Technology  Universal Donor Vector Design

3. Non-Homologous End Joining (NHEJ)
The target gene forms a double-strand break (DSB), and the donor is cut. The cell uses the NHEJ repair mechanism to integrate the linearized donor template into the DSB site, enabling efficient gene knock-in.

CRISPaint Technology  Non-Homologous End Joining (NHEJ)

CRISPaint Technical Advantages

High Efficiency
NHEJ-mediated gene knock-in requires no homology arms, achieving an insertion efficiency of up to 50%
Wide Applicability
Independent of cell division, suitable for various cell types
Flexibility
The universal donor plasmid contains three different Donor-sgRNA target sequences, allowing flexible selection of Frame sgRNAs for correct gene ORF integration

CRISPaint Experimental Workflow

 

BingoPE™ 30-80% No need for double-strand breaks or donor templates – low off-target risk Precise small-fragment knock-ins or single-base corrections

Bingo™ Technology Overview

Bingo™ is a gene editing technology based on Prime Editing-mediated small fragment knock-in, without introducing double-strand breaks (DSBs). The method uses a Cas9 nickase fused to a reverse transcriptase (Cas9n-RT), guided by a prime editing guide RNA (pegRNA) to the target site. Cas9n creates a single-strand nick, and the reverse transcriptase uses the pegRNA template to synthesize the desired DNA sequence at that site, achieving accurate gene insertion.

 

Bingo™ Technical Advantages

Safer
PE technology edits the genome via single-strand nicking, avoiding the instability associated with DSBs and significantly improving overall safety.
Highly precise
The pegRNA contains detailed edit instructions, enabling accurate fragment insertion and minimizing off-target or unintended edits.
Versatile
Supports insertion of small DNA sequences such as stop codons or tag sequences, making it suitable for a wide range of genome editing applications.

Bingo™ Experimental Workflow

 

HES-KI 40%-90% Built-in screening system ensures efficient knock-in C-terminal tagging at essential gene loci

HES-KI Technology Overview

HES-KI (Hotspot-Exon-Selection Knock-In) is a novel knock-in strategy targeting the C-terminal exon region of essential genes using CRISPR editing. A custom knock-in template is designed so that successful integration restores the function of the essential gene while incorporating the desired transgene. In contrast, cells with failed knock-in—such as those with indels caused by NHEJ—lose essential gene function and cannot survive. This enables effective enrichment of correctly edited cells through a built-in positive selection mechanism.

HES-KI Advantages

High Efficiency
The positive selection mechanism significantly boosts knock-in efficiency—reaching up to 68% in various cell types—far surpassing traditional methods by reducing non-specific integration
Stable and Uniform Expression
Knock-in monoclonal cell lines show consistent and stable expression of the target gene
Multiplex Gene Integration
Supports simultaneous integration of multiple genes. For example, multiple CAR genes can be inserted to target various tumor antigens and minimize tumor immune escape
Tunable Expression
By selecting different essential genes as integration sites, the expression level of the transgene can be flexibly modulated

HES-KI Technical Workflow

HES-KI Technical Workflow

Case Study

In this study, AsCas12a ribonucleoproteins (RNPs) were co-transfected with an EGFP donor plasmid into K562 cells, achieving targeted integration of the EGFP gene via the HES-KI (high-efficiency knock-in) strategy. Without applying selection markers, the knock-in efficiency in polyclonal cells reached 37%, and EGFP insertion did not noticeably affect cell growth. Single-clone cell lines established from these polyclonal populations maintained stable EGFP mRNA expression over 15 consecutive passages, demonstrating durable and reliable gene integration.
① Knock-in efficiency in polyclonal cells reached 37%.
K562 cells
EGFP knock-in in K562 cells.
② Doubling times of K562 EGFP-KI single clones were comparable to wild-type (WT) single clones, indicating that EGFP insertion did not affect cell growth.
EGFP insertion does not affect the growth of K562 cells.
③ EGFP mRNA expression levels were consistent across different K562 EGFP-KI single clones, reflecting high clonal uniformity.
EGFP knock-in single clones show high uniformity.
④ After 15 passages of different K562 EGFP-KI monoclonal cell lines, EGFP mRNA expression remained stable.
EGFP mRNA expression is stable.
In this case, CHO-K1 and HEK293T cells were co-transfected with CRISPR/Cas9 ribonucleoproteins (RNPs) and an EGFP donor plasmid. Using the HES-KI (High-Efficiency Knock-In) strategy, site-specific integration of the EGFP gene was successfully achieved. Without any antibiotic selection, the knock-in efficiency reached up to 55% in CHO-K1 polyclonal cells and 68% in HEK293T polyclonal cells. Moreover, the EGFP insertion did not cause any significant impact on cell growth.
①Knock-in efficiency of polyclonal cells
293T CHO-K1
293T
CHO-K1
293T-EGFP
CHO-K1-EGFP
②EGFP mRNA expression in CHO-K1/HEK293T-EGFP cells remained stable across multiple passages
EGFP mRNA expression in CHO-K1/HEK293T-EGFP cells remained stable across multiple passages
Using EDITGENE Bingo™ platform, pegRNAs and nick sgRNAs were designed for the target loci, and plasmid sequences were verified by sequencing. The plasmids, including auxiliary plasmids and pegRNAs/nick sgRNAs, were transiently transfected into Hela cells, and genomic DNA was extracted to confirm the base insertions.
Cell type cell pool editing efficiency Sequencing peak profile Number of single clones selected Number of homozygous single clones
Hela 64% WT:TCCGCTACCACCAATGCCTAATGCATTTGG
MT:TCCGCTACCACCAATGCTAATAACTAATGCATTTGG
Sequencing chromatogram of a base insertion cell line generated in Hela cells using Prime Editing.
11 1
This case was carried out using EDITGENE’s FLASH-KI gene knock-in platform. Several sgRNAs were carefully designed for the target locus, and high-performing sgRNAs were identified through transfection-based screening. A donor vector containing the Neo resistance gene and the EGFP reporter gene was then designed according to the customer’s requirements. EDITGENE’s proprietary FLASH delivery reagent was used to co-deliver the RNP complex and donor DNA into H9 human embryonic stem cells (hESC-H9). Genomic DNA extraction and sequencing of the polyclonal cell pool confirmed successful insertion of the target fragment at the intended locus. Fluorescence analysis of the cell pool further confirmed expression of the inserted EGFP reporter gene.
Cell Type Knock-in Efficiency in the Cell Pool Insertion fragment amplicon sequencing results Number of Monoclonal Clones Screened Number of Homozygous Monoclonal Clones
hESC-H9 25.5%
22 5
Fluorescence Image of EGFP Knock-in in H9 Cells

 

Advantage and Characteristic

Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic
Optimazied Strategy
We have create a unique sgRNA Design Logic

Reference Materials

Article Title: Modulation of cell cycle increases CRISPR-mediated homology-directed DNA repair

This study explores a method to enhance CRISPR-mediated HDR efficiency by synchronizing the cell cycle. Using small molecules to modulate the cell cycle, researchers achieved a 1.2- to 1.5-fold increase in knock-in efficiency across various cell lines. The study also demonstrated this approach's application in animal embryos, significantly increasing knock-in frequency in pig embryos. This technique improves knock-in success by guiding cells to an HDR-favorable cycle stage, offering a new optimization strategy for CRISPR gene editing.

Article Title: CLASH enables large-scale parallel knock-in for cell engineering

The CLASH (Cas9-Linked Adaptor Synthesis for Homology-directed repair) technology enables efficient large-scale gene knock-in for cell engineering. This method combines the Cas9 protein and adaptor synthesis, allowing parallel knock-in across various cell types. By providing specific adaptors during the DNA repair process, it significantly enhances homology-directed repair (HDR) efficiency, thereby increasing knock-in success rates. This technology shows great potential in cell engineering and gene editing, especially for complex bioengineering applications requiring multi-gene modifications.

Selected Customer Resources

IF=50.5
Nature

Abstract:

To date, more than half of global hepatocellular carcinoma (HCC) cases occur in China, yet comprehensive whole-genome analyses focusing on HBV-related HCC within the Chinese population remain scarce. To address this challenge, researchers initiated the China Liver Cancer Atlas (CLCA) project, aiming to conduct large-scale whole-genome sequencing to unravel the unique pathogenic mechanisms and evolutionary trajectories of HCC in China.

The researchers performed deep whole-genome sequencing on 494 HCC tumor samples, with an average depth of 120×, alongside matched blood controls, providing a detailed genomic landscape of HBV-associated HCC. Beyond confirming well-known coding driver genes such as TP53 and CTNNB1, the study identified six novel coding drivers—including FGA—and 31 non-coding driver genes.

Additionally, the research uncovered five new mutational signatures, including SBS_H8, and characterized the presence of extrachromosomal circular DNA (ecDNA) formed via HBV integration, which contributes to oncogene amplification and overexpression. Functional validation experiments demonstrated that mutations in genes such as FGA, PPP1R12B, and KCNJ12 significantly enhance HCC cell proliferation, migration, and invasion.

These findings not only deepen our insights into the genomics of HCC, but also open up new potential targets for diagnosis and therapy. View details>>

Candidate driver landscape

 

IF=27.4
Advanced Materials

Abstract:

During the acute inflammatory phase of tendon injury, excessive activation of macrophages leads to the overexpression of SPP1, which encodes osteopontin (OPN), thereby impairing tissue regeneration. The CRISPR-Cas13 system holds great promise for tissue repair due to its unique RNA editing and rapid degradation capabilities; however, its application has been limited by the lack of efficient delivery methods.

To address this, the researchers systematically screened various cationic polymers targeting macrophages and developed a nanocluster carrier capable of efficiently delivering Cas13 ribonucleoprotein complexes (Cas13 RNPs) into macrophages. Utilizing a reactive oxygen species (ROS)-responsive release mechanism, this system specifically suppresses the overexpression of SPP1 in macrophages within the acute inflammatory microenvironment of tendon injury.

Experimental results demonstrated that this targeted delivery strategy significantly reduced the population of SPP1-overexpressing macrophages induced by injury, inhibited fibroblast activation, and alleviated peritendinous adhesion formation. Furthermore, the study elucidated that SPP1 promotes fibroblast activation and migration through the CD44/AKT signaling pathway, and that inhibiting this pathway effectively mitigates adhesion formation following tendon injury. View details>>

Schematic diagram illustrating immune microenvironment-activated mRNA editing strategies of macrophages for PA therapy

IF=12.8
Biomaterials

Abstract:

Spinal cord injury (SCI) is a severe disabling condition that causes permanent loss of sensory, autonomic, and motor functions. While stem cell therapies, particularly mesenchymal stem cells (MSCs), show great promise for SCI treatment, their limited regenerative capacity restricts their application in tissue repair. The researchers observed that extracellular vesicles derived from antler bud progenitor cells (EVsABPC) may carry bioactive signals that promote tissue regeneration. Accordingly, they isolated and engineered EVs from ABPCs for SCI therapeutic investigation.

The study found that EVsABPC significantly enhanced neural stem cell (NSC) proliferation, promoted axonal growth, reduced neuronal apoptosis, and modulated inflammation by shifting macrophage polarization from the pro-inflammatory M1 phenotype to the anti-inflammatory M2 phenotype. Moreover, engineered EVsABPC modified with cell-penetrating peptides demonstrated improved targeting to the SCI lesion site, markedly enhancing neural regeneration and functional motor recovery. These findings highlight EVsABPC as a promising candidate for SCI therapy. View details>>

Graphical abstract

IF=11.3
Journal of Hazardous Materials

Abstract:

S-metolachlor (S-MET) is one of the most widely produced and applied herbicides in China. Owing to its chemical properties, it tends to persist in soil and easily contaminates surface and groundwater through leaching and runoff. This environmental persistence poses a serious threat to plant development and, through the food chain, to human health.

To address the limitations of current detection technologies and meet the growing demand for high-efficiency analytical tools, the researchers employed a mammalian expression system to generate recombinant antibodies targeting S-MET.

Building on the successful expression of these antibodies, they established a sensitive immunoassay for monitoring S-MET residues in various environmental water samples. The icELISA results showed that the recombinant antibodies retained the sensitivity, specificity, and biological activity of the original monoclonal antibodies, delivering accurate and reproducible detection in river water, agricultural runoff, and tap water. View details>>

Graphical abstract

 

IF=10.7
Biosensors and Bioelectronics

Abstract:

MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that regulate gene expression by interacting with the mRNAs of target genes. Given their crucial role in the development and progression of various diseases, miRNAs have emerged as promising biomarkers for clinical diagnostics.

In this study, researchers established a novel detection platform, termed DBmRCA, which combines dumbbell probe-initiated multi-rolling circle amplification with the high-sensitivity signal output of CRISPR/Cas12a. This enzyme-free, isothermal method enables accurate quantification of miRNA within just 30 minutes.

Clinical validation revealed that the expression levels of miR-200a and miR-126 were significantly downregulated in lung cancer tissues, and results from DBmRCA were consistent with those obtained by conventional techniques. With its high sensitivity, rapid turnaround, and simplified workflow, the DBmRCA platform presents a reliable tool for miRNA detection and holds strong promise for early diagnosis and therapeutic monitoring of lung cancer. View details>>

Graphical abstract

FAQ

Gene knock-in plays a crucial role in drug development. It is used in target validation by introducing specific genes into cell lines or animal models to confirm drug target efficacy. It also aids in establishing disease models, testing drug efficacy and safety in these models, and supporting drug screening through high-throughput screening in knock-in cell lines to identify potential drug candidates. Additionally, gene knock-in helps uncover drug mechanisms, optimize drug structure, and improve dosing strategies, expediting drug development while enhancing efficacy and safety.
EDITGENE’s advantages in gene knock-in technology include: Guaranteed results: With 10 years of CRISPR gene editing experience and a team of PhDs from world-renowned institutions offering one-on-one support. High precision: EDITGENE’s optimized tools reduce off-target effects, enhancing editing accuracy. High efficiency: EDITGENE’s technology platform improves knock-in success rates, accelerating experimental progress. Customized service: Tailored knock-in solutions to meet specific research or therapeutic goals.
Gene knock-in technology involves inserting an exogenous gene sequence into a specific location within the genome for gene function studies. Edigene utilizes advanced gene editing tools, such as the CRISPR/Cas9 system, to guide nucleases to cut the target DNA, and employs homology-directed repair or non-homologous end joining to accurately insert the gene at the desired location, achieving efficient and precise gene knock-in.

Contact Us

*
*
*
*
How did you hear about us:
Contact Us
*
*
*
*
How did you hear about us: