Bingo™ Prime Editing Platform
Bingo™ PE7 Prime Editing Platform
EDITGENE has established a mature gene point mutation editing platform, Bingo™ PE7, which is based on the latest Prime Editing editing strategy (PE7). This platform has advanced and mature scheme design and experimental system, which can efficiently and accurately obtain the cell models with random base transition, small fragment knockout or insertion. To resolve the problems in your experimental process, such as inaccurate editing, low editing efficiency, low transfection efficiency, and low efficiency in obtaining homozygotes, to accelerate your research progress.
Empower your experiments with Bingo™ PE7 --- our expert-designed service platform delivers the precision and reliability your research demands.
Technical Principles of Prime Editing
Bingo™ Service Advantages
Efficient editing system
Based on the PE7 gene editing strategy, the editing efficiency and homozygosity probability are greatly improved, which can effectively edit the difficult sites
Efficient pegRNA design algorithm system
The pegRNA design algorithm is exclusively developed with the editing efficiency of up to 100% without off-target events
Enhanced Cas9n-RT editing enzyme system
The optimized Cas9n-RT has stronger editing stability and activity
Efficient transfection system
The unique transfection system that is 10 times more efficient than traditional methods
Efficient single clone sorting technology
3D bioprinting enables rapid single-clone sorting, with full well-plate seeding in 5 minutes, >3-fold improved cell survival, and image-based verification of monoclonality.
Technical support provided by experienced experts
With over 10 years of gene editing experience for simple and complex editing projects
Related technical services and products
Customization of gene point mutation cell lines
Customized cell lines with precise small-fragment deletion/insertion
Gene therapy drug development based on PE editing strategy
In-stock gene mutation cell lines
Customization of gene point mutation editing vectors
Case Study
Generation of Single-Base Mutation Cell Lines in A549, K562, and iPSC Cells Using Prime Editing
Using EDITGENE’s Bingo™ platform, pegRNAs and nick sgRNAs were designed for the target loci, and plasmid sequences were verified by sequencing. The plasmids, including the auxiliary plasmids and pegRNAs/nick sgRNAs, were transiently transfected into cells. Genomic DNA was subsequently extracted to confirm the introduction of the desired point mutations.
| Cell Type | Cell Pool Editing Efficiency | Sequencing Peak Profile | Number of Single Clones Selected | Number of Homozygous Single Clones |
|---|---|---|---|---|
| A549 | 98% | WT:GAGTTGCGCATTAACAGTGGTGGGA MT:GAGTTGCGCATTAACGGTGGTGGGA  |
7 | 6 |
| K562 | 82% | WT:GTGGAGAAGCCCTTCGGGAGGGACC MT:GTGGAGAAGCCCCTCGGGAGGGACC  |
6 | 4 |
| IPSC | 60% | WT:AGGGAACCCCAAGTTGAACTTGGCTT MT:AGGGAACCCCAAGTTCAACTTGGCTT  |
8 | 2 |
Generation of Double-Point Mutation Cell Lines in A549 Cells Using Prime Editing
Using the Bingo™ platform, pegRNAs and nick sgRNAs were designed and plasmid sequences verified by sequencing. The plasmids were transiently transfected into A549 cells, and genomic DNA was extracted to validate the double-point mutations.
| Cell Type | Cell Pool Editing Efficiency | Sequencing Peak Profile | Number of Single Clones Selected | Number of Homozygous Single Clones |
|---|---|---|---|---|
| A549 | 56% and 63% | WT:CAGTCCTCAAAATCTCCATCCCTGT MT:CAGTCCTCAAAACCCCCATCCCTGT  |
4 | 2 |
Generation of Base Insertion Cell Lines in Hela Cells Using Prime Editing
Target-site pegRNAs and nick sgRNAs were designed on the Bingo™ platform, and plasmid sequences were verified. The plasmids were transiently transfected into A549 cells, and genomic DNA was extracted to confirm the base insertions.
| Cell Type | Cell Pool Editing Efficiency | Sequencing Peak Profile | Number of Single Clones Selected | Number of Homozygous Single Clones |
|---|---|---|---|---|
| Hela | 64% | WT:TCCGCTACCACCAATGCCTAATGCATTTGG MT:TCCGCTACCACCAATGCTAATAACTAATGCATTTGG  |
11 | 1 |
