T7 In Vitro Transcription Kit

This transcription kit features an optimized in vitro transcription system using T7 RNA Polymerase. It efficiently transcribes DNA sequences downstre  more

Cat.No: EDN-T702

Price:  Contact Us

规格

25 rxns 100 rxns

Quantity

Product Description

This transcription kit features an optimized in vitro transcription system using T7 RNA Polymerase. It efficiently transcribes DNA sequences downstream of the T7 promoter from either supercoiled plasmid DNA or linear DNA templates containing a T7 promoter. This kit is suitable for producing high-concentration RNA transcripts longer than 6,000 nt. Using 1 μg of DNA template in a 20 μL reaction, 150-280 μg of RNA can be generated. For milligram-scale RNA production, the reaction can be scaled up proportionally. The synthesized RNA is compatible with applications such as in vitro translation, RNase protection assays, RNA cleavage, and labeling of hybridization probes.

 

Product components

Component EDN-T701(25 rxns) EDN-T702(100 rxns)
T7 Transcription Enzyme Mix 50 μl 200 μl
5×T7Transcription Reaction Buffer 100 μl 400 μl
ATP(100mM) 50 μl 200 μl
GTP(100mM) 50 μl 200 μl
CTP(100mM) 50 μl 200 μl
UTP(100mM) 50 μl 200 μl
DNaseI(1 unit/ul) 50 μl 200 μl
500mM EDTA(pH 8.0) 25 μl 100 μl
RNase-free Water 1 ml 5 ml
Transcription Control Template(0.5μg/μl) 10 μl 40 μl

 

Template reference

T7 Promoter:5'-TAATACGACTCACTATAGGG#-3'    #:G/A

Terminator:5'TTCCATCTGTTTTCTTATCTGTTCTTTCATCTGTTCTTTTATCTGTTTGTTT 3'

Template Dosage RNA Yield
2 μg 170~320 μg
1 μg 150~280 μg
500 ng 100~180 μg
200 ng 40~80 μg
100 ng 15~40 μg
50 ng 10~20 μg
10 ng 4~8 μg
l ng 2~6 μg

Data Reference

Storage Condition

Store at -20 °C for up to one year.

An Instruction Manual

Related Product Related Product
Contact Us
*
*
*
*
How did you hear about us: