T7 In Vitro Transcription Kit
This transcription kit features an optimized in vitro transcription system using T7 RNA Polymerase. It efficiently transcribes DNA sequences downstre more
Cat.No: EDN-T702
规格
25 rxns 100 rxns
Quantity
Product Description
This transcription kit features an optimized in vitro transcription system using T7 RNA Polymerase. It efficiently transcribes DNA sequences downstream of the T7 promoter from either supercoiled plasmid DNA or linear DNA templates containing a T7 promoter. This kit is suitable for producing high-concentration RNA transcripts longer than 6,000 nt. Using 1 μg of DNA template in a 20 μL reaction, 150-280 μg of RNA can be generated. For milligram-scale RNA production, the reaction can be scaled up proportionally. The synthesized RNA is compatible with applications such as in vitro translation, RNase protection assays, RNA cleavage, and labeling of hybridization probes.
Product components
| Component | EDN-T701(25 rxns) | EDN-T702(100 rxns) |
| T7 Transcription Enzyme Mix | 50 μl | 200 μl |
| 5×T7Transcription Reaction Buffer | 100 μl | 400 μl |
| ATP(100mM) | 50 μl | 200 μl |
| GTP(100mM) | 50 μl | 200 μl |
| CTP(100mM) | 50 μl | 200 μl |
| UTP(100mM) | 50 μl | 200 μl |
| DNaseI(1 unit/ul) | 50 μl | 200 μl |
| 500mM EDTA(pH 8.0) | 25 μl | 100 μl |
| RNase-free Water | 1 ml | 5 ml |
| Transcription Control Template(0.5μg/μl) | 10 μl | 40 μl |
Template reference
T7 Promoter:5'-TAATACGACTCACTATAGGG#-3' #:G/A
Terminator:5'TTCCATCTGTTTTCTTATCTGTTCTTTCATCTGTTCTTTTATCTGTTTGTTT 3'
| Template Dosage | RNA Yield |
| 2 μg | 170~320 μg |
| 1 μg | 150~280 μg |
| 500 ng | 100~180 μg |
| 200 ng | 40~80 μg |
| 100 ng | 15~40 μg |
| 50 ng | 10~20 μg |
| 10 ng | 4~8 μg |
| l ng | 2~6 μg |
Data Reference

Storage Condition
Store at -20 °C for up to one year.